Professional Writers
We assemble our team by selectively choosing highly skilled writers, each boasting specialized knowledge in specific subject areas and a robust background in academic writing
Find The Best Nursing Paper Writers For Your Assignments
You Can order for custom written paper 24/7! by completig a form in 3 steps. Get those desired coursework assessment grades!
Posted: February 9th, 2023
Explain the concept of the “Neutral Theory of Molecular Evolution”
Take a look at Extended Data Figure 3 from Huerta-Sánchez et al (2014: 2024 – Essay Writing Service | Write My Essay For Me Without Delay). How does this figure emphasize that the Tibetan allele for EPAS1 came from Denisovans? (10 points)
2. You are given the following seven aligned sequences from a single population (variants with respect to the first sequence are shown in bold). Justify whether or not you see any evidence of selection. (20 points)
TGGAGTGTGACCATAGCGAT
TGGAGTTTGACCATAGCCAT
TGGAGTGTGACCATAACCAT
TGGTGTTTGCCCATAACGAT
TGGTGTGTGACCATAGCGAT
TGGTGTGTGCCCATAGCGAT
TGGAGTGTGACCATAACGAT
3. Explain the concept of the “Neutral Theory of Molecular Evolution” and how it relates to the idea of a molecular clock? (10 points)
Extended Data Figure 3 from Huerta-Sánchez et al (2014: 2024 – Essay Writing Service | Write My Essay For Me Without Delay) shows the distribution of alleles for the gene EPAS1 in various populations. The figure emphasizes that the Tibetan allele for EPAS1 came from Denisovans by showing that this particular allele is found only in Tibetans and Denisovans, and not in any other populations studied. This suggests that the allele was introduced into the Tibetan population through interbreeding with Denisovans.
The seven aligned sequences show evidence of genetic variation within the population, but it is not possible to determine if there is evidence of selection based on this limited data. To determine if selection is occurring, additional information is needed, such as the functional significance of the alleles, the frequency of the alleles in the population, and whether the alleles are associated with any particular traits.
The Neutral Theory of Molecular Evolution posits that most evolutionary changes at the molecular level, such as changes in DNA sequences, are due to neutral processes such as genetic drift and mutation, rather than natural selection. The concept of a molecular clock refers to the idea that the rate of accumulation of mutations in DNA sequences is roughly constant over time, allowing the estimation of evolutionary divergence times between species based on the number of differences in their DNA sequences. The Neutral Theory suggests that this molecular clock reflects the accumulation of neutral mutations, which are not subject to natural selection and therefore evolve randomly over time.
Why choose us
You Want Quality and That’s What We Deliver
Discounted Prices
Our service is committed to delivering the finest writers at the most competitive rates, ensuring that affordability is balanced with uncompromising quality. Our pricing strategy is designed to be both fair and reasonable, standing out favorably against other writing services in the market.
AI & Plagiarism-Free
Rest assured, you'll never receive a product tainted by plagiarism or AI-generated content. Each paper is research-written by human writers, followed by a rigorous scanning process of the final draft before it's delivered to you, ensuring the content is entirely original and maintaining our unwavering commitment to providing plagiarism-free work.
How it works
When you decide to place an order with Nurscola, here is what happens: